WebbChromatiaceae family (i.e. Chromatium okenii, Lamprocystis purpurea, Lamprocystis roseopersicina, Lamprocystis sp. popu-lationD,Candidatus‘Thiodictyonsyntrophicum’population F, Thiocystis chemoclinalis, and Thiocystis cadagnonensis) and green sulfur bacteria from the Chlorobiaceae family (i.e. … WebbLamprocystis roseopersicina: Lamprocystis roseopersicina (KA%BCtzing 1849) Schroeter 1886 (Approved Lists 1980) Encyclopedia of life: Bacterium rubescens: …
Transfer of Pfennigia purpurea tindall 1999 (Amoebobacter …
Webb6 aug. 2024 · For cluster-forming organisms (Thiodictyon syntrophicum, Lamprocystis purpurea, Lamprocystis roseopersicina, and Lamprocystis spp.), the cell size (length and width, for biovolume and C-content ... Webb26 feb. 2010 · Lamprocystis roseopersicina: Full Abstract is below Advertisement. Type Status. This is the type strain for Lamprocystis roseopersicina (Kützing 1849) Schroeter 1886 (Approved Lists 1980). 16S gene. AJ006063. Citation. When referring to this Abstract, please use its Digital Object Identifier and cite NamesforLife. bunzlsafety.ca
authors.library.caltech.edu
Webb44441. 82. 7. 299. 238. 37. CTAGCATAACCCCTTGGGGCC GGAATTGTTATCCGCTCACAATTCCCCTATAG Bacillus megaterium Desulfobacterium vacuolatum DSM 3385 pET-28a(+) DSM 771 ... WebbIt was mainly composed of Amoebobacter purpureus, Thiopedia rosea and Lamprocystis roseopersicina. A population of Lamprocystis roseopersicina was dominant in Höllerersee, too, causing the highest BChl a concentration at 10 m. Just above, a thin phy- coerythrin-containing cyanobacterial population (Oscillatoria rubescens) was found. WebbLamprocystis purpurea Lamprocystis roseopersicina unclassified Lamprocystis (in: Bacteria) environmental samples Marichromatium Marichromatium bheemlicum Marichromatium chilcum Marichromatium chrysaorae Marichromatium gracile Marichromatium indicum Marichromatium litoris Marichromatium purpuratum hallmark elf on the shelf